Abstract
About 10,000 ha of pumpkins [Cucurbita pepo L. and Cucurbita moschata (Duchesne) Duchesne ex Poir] are produced annually in Illinois. In 2010 and 2011, severe leaf and fruit symptoms typical of bacterial spot caused by Xanthomonas cucurbitae (ex Bryan) Vauterin et al. were observed in pumpkin fields in Illinois, resulting in estimated yield losses of 3 to 90%. Leaf infection was observed from the time of spreading vines until harvest, and infection of fruit occurred from when fruit weights were 0.25 kg until harvest. Leaves had small (2 to 4 mm), angular, yellow spots (1). Fruit had small (1 to 3 mm in diameter), slightly sunken, circular spots, each with a beige center and dark brown halo (1). A survey in 2010 showed that bacterial spot occurred in 40 of 50 pumpkin fields with symptoms on 3 to 94% of fruit in a field (average 34%). A survey in 2011 showed fruit with bacterial spot symptoms in 57 of 65 pumpkin fields, with lesions on 3 to 87% of the fruit in a field (average 24%). Six to twelve symptomatic pumpkins were collected from each field, and X. cucurbitae was isolated from the fruit by surface-disinfesting an area of the fruit with lesions with paper tissue soaked in 95% ethanol. One or two lesions/fruit were cut out with a sterile blade, inserted into an eppendorf tube containing 1 ml of sterile distilled water (SDW), the tubes shaken manually, and a loopful of the bacterial suspension from each tube streaked onto nutrient agar (NA). The plates were incubated at 24°C for 3 to 4 days. Single colonies of each of the isolated bacterium were prepared by streaking isolated colonies onto additional plates of NA and selecting well-separated colonies. The colonies were identified as X. cucurbitae by culturing on yeast extract-dextrose–CaCO 3 (YDC) agar, on which xanthomonas-like yellow colonies with mucoid growth developed. The isolates were gram-negative, O + and F – in the oxidative and fermentative test, oxidase negative, and motile. The isolates hydrolyzed starch and esculin, but did not hydrolyze nitrate, and grew on YDC agar at 33°C. Confirmation of the species identity was achieved using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay (2), which produced a 1,500-bp band. Koch's postulates were carried out for 40 isolates of X. cucurbitae from 40 different fields on pumpkin cv. Howden in a greenhouse. Koch's postulates for five of the isolates were also conducted in a field. Bacterial inoculum was cultured on Luria Broth agar medium and a suspension of 10 8 cfu/ml prepared in SDW. Pumpkin leaves and fruit were spray-inoculated. In the greenhouse test, each isolate was inoculated onto five leaves of each of four plants. In the field, each isolate was inoculated onto 10 leaves and one fruit of each of 10 plants. A positive control treatment consisted of inoculating pumpkin leaves and fruit with a known X. cucurbitae isolate. A negative control treatment entailed using SDW for inoculation. Lesions developed on leaves and fruit of plants inoculated with the positive control and suspected X. cucurbitae isolates. X. cucurbitae was reisolated from symptomatic leaves and fruit and identified by culturing on YDC agar, and using the PCR assay. No symptoms developed on leaves or fruit sprayed with SDW, and attempts to isolate X. cucurbitae from these plants did not result in development of any bacterial colonies. References: (1) Babadoost et al. Univ. of Illinois Extension C1392, 2004. (2) Leite et al. Appl. Environ. Microbiol. 60:1068, 1994.
Abstract from the paper’s OpenAlex record, shown for indexing and research. Copyright remains with the authors or the publisher. Read at the source ↗
The text the model read, with the source record’s inline markup (italics, sub- and superscripts) rendered and its character entities decoded; quote offsets refer to the raw text.
Claims 13
Claim · model-written summary
Bacterial spot symptoms in Illinois pumpkin fields caused estimated yield losses of 3 to 90%.
Verbatim
e0“severe leaf and fruit symptoms typical of bacterial spot caused by Xanthomonas cucurbitae (ex Bryan) Vauterin et al. were observed in pumpkin fields in Illinois, resulting in estimated yield losses of 3 to 90%”
Claim · model-written summary
Leaf infection persisted from spreading vines until harvest.
- Taxon
- Pumpkint0
- Interactor
- Xanthomonas cucurbitaeXanthomonas cucurbitaee1pathogen
- Outcome
- Leaf infectione0
- Qualifier
- from the time of spreading vines until harveste0
Verbatim
t0“Pumpkin”
e0“Leaf infection was observed from the time of spreading vines until harvest”
e1“Xanthomonas cucurbitae”
Claim · model-written summary
Fruit infection occurred from 0.25 kg fruit weight until harvest.
- Taxon
- Pumpkint0
- Interactor
- Xanthomonas cucurbitaeXanthomonas cucurbitaee1pathogen
- Outcome
- infection of fruite0
- Qualifier
- from when fruit weights were 0.25 kg until harveste0
Verbatim
t0“Pumpkin”
e0“infection of fruit occurred from when fruit weights were 0.25 kg until harvest”
e1“Xanthomonas cucurbitae”
Claim · model-written summary
Leaves showed small angular yellow spots of 2 to 4 mm.
Verbatim
t0“Pumpkin”
e0“Leaves had small (2 to 4 mm), angular, yellow spots”
e1“Xanthomonas cucurbitae”
Claim · model-written summary
Fruit showed slightly sunken circular spots of 1 to 3 mm with beige centers and dark halos.
Verbatim
t0“Pumpkin”
e0“Fruit had small (1 to 3 mm in diameter), slightly sunken, circular spots, each with a beige center and dark brown halo”
e1“Xanthomonas cucurbitae”
Claim · model-written summary
In 2010 bacterial spot occurred in 40 of 50 pumpkin fields.
- Taxon
- pumpkine0
- Interactor
- Xanthomonas cucurbitaeXanthomonas cucurbitaee1pathogen
- Outcome
- bacterial spot occurrede0
- Value
- 40 of 50e0
Verbatim
t0“Pumpkin”
e0“A survey in 2010 showed that bacterial spot occurred in 40 of 50 pumpkin fields”
e1“Xanthomonas cucurbitae”
Claim · model-written summary
In 2010 fruit symptoms ranged from 3 to 94% in a field, averaging 34%.
Verbatim
e0“pumpkin fields with symptoms on 3 to 94% of fruit in a field (average 34%)”
e1“Xanthomonas cucurbitae”
Claim · model-written summary
In 2011 fruit symptoms appeared in 57 of 65 pumpkin fields.
- Taxon
- pumpkine0
- Interactor
- Xanthomonas cucurbitaeXanthomonas cucurbitaee1pathogen
- Outcome
- bacterial spot symptomse0
- Value
- 57 of 65e0
Verbatim
e0“fruit with bacterial spot symptoms in 57 of 65 pumpkin fields”
e1“Xanthomonas cucurbitae”
Claim · model-written summary
In 2011 lesions ranged from 3 to 87% of fruit in a field, averaging 24%.
Verbatim
t0“Pumpkin”
e0“lesions on 3 to 87% of the fruit in a field (average 24%)”
e1“Xanthomonas cucurbitae”
Claim · model-written summary
X. cucurbitae was isolated from symptomatic pumpkin fruit and identified by culture and PCR.
- Taxon
- pumpkine2
- Interactor
- X. cucurbitaeXanthomonas cucurbitaee0pathogen
- Outcome
- X. cucurbitae was isolated from the fruite0
Verbatim
e0“symptomatic pumpkins were collected from each field, and X. cucurbitae was isolated from the fruit”
e1“Confirmation of the species identity was achieved using primers RST2”
e2“pumpkin cv. Howden”
Claim · model-written summary
Suspected X. cucurbitae isolates produced lesions on inoculated pumpkin leaves and fruit.
- Taxon
- Pumpkint0
- Treatment
- suspected X. cucurbitae isolatese0
- Interactor
- X. cucurbitaeXanthomonas cucurbitaee0pathogen
- Outcome
- Lesions developed on leaves and fruite0
- Comparator
- SDWe1
Not reportedDirection
Verbatim
t0“Pumpkin”
e0“Lesions developed on leaves and fruit of plants inoculated with the positive control and suspected X. cucurbitae isolates”
e1“negative control treatment entailed using SDW for inoculation”
Claim · model-written summary
X. cucurbitae was reisolated from symptomatic inoculated leaves and fruit.
- Taxon
- Pumpkint0
- Interactor
- X. cucurbitaeXanthomonas cucurbitaee0pathogen
- Outcome
- X. cucurbitae was reisolatede0
Verbatim
t0“Pumpkin”
e0“X. cucurbitae was reisolated from symptomatic leaves and fruit”
Claim · model-written summary
SDW sprayed pumpkin plants had no symptoms or bacterial colonies.
- Taxon
- Pumpkint0
- Treatment
- SDWe0
- Interactor
- X. cucurbitaeXanthomonas cucurbitaee0pathogen
- Outcome
- No symptoms developed on leaves or fruite0
Not reportedComparatorDirection
Verbatim
t0“Pumpkin”
e0“No symptoms developed on leaves or fruit sprayed with SDW, and attempts to isolate X. cucurbitae from these plants did not result in development of any bacterial colonies”