Abstract
Knoxia roxburghii (Spreng) M.A. Rau (“Hong Daji”), a perennial Rubiaceae herb and traditional Chinese medicine for cancers, carbuncles, and ascites, is widely distributed in southern China and Southeast Asia (Chen et al. 2022; Zhang et al. 2023). For the purpose of safeguarding the sustainable utilization of the wild resources, it is cultivated in Yunnan, Guangxi, and Guangdong of China. In April 2025, root-knot nematode disease was observed on K. roxburghii in Anning, Yunnan (24.9894° N, 102.4319° E), China. K. roxburghii plants infected with root knot nematodes formed root knots on both tap roots and fibrous roots, which could lead to root necrosis in severe cases. In addition, the mean weight of root knot on the tap roots accounted for 33.71 % of the total root weight per plant (n=20). Rhizosphere soil samples were collected at a depth of 15 cm, and second-stage juveniles (J2s) of nematodes were isolated using the Baermann funnel method as described by Cesarz et al. (2019). Nematode J2s density within soil samples was 24.25 ± 10.30 /100 g soil (n=3). Egg masses and females were isolated from diseased roots. J2s were obtained by incubating egg masses at 25 °C. Morphological analysis showed characteristics consistent with Meloidogyne hapla described by Whitehead (1968) and Wu (2023). For J2s (n=20), body length= 462.59 ± 48.19 μm, body width 23.04 ± 1.63 μm, tail length= 48.42 ± 8.77 μm, stylet length= 14.03 ± 1.18 μm, distance from dorsal esophageal gland opening to the stylet knot (DGO)= 3.90 ± 0.68 μm; for females (n=20), pear-shaped, body length= 574.55 ± 87.38 μm, maximum body width= 379.93 ± 62.06 μm, stylet length= 11.36 ± 1.46 μm, DGO= 3.02 ± 0.39 μm, stylet median bulb width (MBW)= 24.54 ± 6.09 μm, the perineum morphology is low dorsal arch round, with a typical inferior protrusion near the anus. Molecular identification was performed via amplifying 28S rDNA D2/D3 and ITS region by primers D2A/D3B (ACAAGTACCGTGAGGAAAGTTG/TCGGAAGGAACCAGCTACTA) and TW81/AB28 (GTTTCCGTAGGTGAACCTGC/ATATGCTTAAGTTCAGCGGGT), respectively (Subbotin et al. 2001; 2006). D2/D3 and ITS sequencing (GenBank accessions PV747744 and PV746187) revealed 99.78 - 100 % similarity to M. hapla sequences (OQ269680.1 and JX465560.1). Phylogenetic trees (MEGA11, neighbor-joining method) clustered the nemaode with M. hapla. Inoculation tests were performed in a greenhouse, with the average temperature maintained at 25 ℃ and natural, unshaded lighting. Approximately 1000 J2s per plant were inoculated onto 30 healthy potted K. roxburghii plants, while 30 potted control plants without nematodes. After 90 days, typical gall symptoms were observed on inoculated plants, whereas no symptoms were detected in the control group. Molecular reconfirmation confirmed M. hapla. The gall index (GI) was assessed using the number of galls rated on a 0 to 5 scale (Brito et al. 2020). The inoculated K. roxburghii plants had an average of GI 1.84 ± 0.94, eggs/g root 39.13 ± 17.27, egg masses/root 14.00 ± 5.62, and a reproduction factor (RF) 4.07 ± 1.64. To our knowledge, this is the first report of M. hapla infecting K. roxburghii in Yunnan, China. This study not only lays a scientific foundation for early disease warning, but also holds significant scientific significance and application value for ensuring the safe production of K. roxburghii.
Abstract from the paper’s OpenAlex record, shown for indexing and research. Copyright remains with the authors or the publisher. Read at the source ↗
The text the model read, with the source record’s inline markup (italics, sub- and superscripts) rendered and its character entities decoded; quote offsets refer to the raw text.
Claims 14
Claim · model-written summary
Root-knot disease was observed on K. roxburghii in Anning, Yunnan.
- Taxon
- Knoxia roxburghiiKnoxia roxburghiit0
- Interactor
- root-knot nematode
_penetrates_a_tomato_root_-_USDA-ARS.jpg?width=60)
Meloidogynee0pathogen - Outcome
- root-knot nematode diseasee0
- Setting
- Anning, Yunnane0
Organisms pictured · Representative pictures of the matched species, not figures from the paper.
_penetrates_a_tomato_root_-_USDA-ARS.jpg?width=500)
Verbatim
t0“Knoxia roxburghii”
e0“root-knot nematode disease was observed on K. roxburghii in Anning, Yunnan”
Claim · model-written summary
Infected K. roxburghii formed root knots on tap and fibrous roots, with possible necrosis in severe cases.
- Taxon
- Knoxia roxburghiiKnoxia roxburghiit0
- Interactor
- root knot nematodesMeloidogynee0pathogen
- Outcome
- root knots on both tap roots and fibrous rootse0
- Qualifier
- root necrosis in severe casese0
Organisms pictured · Representative pictures of the matched species, not figures from the paper.
Verbatim
t0“Knoxia roxburghii”
e0“K. roxburghii plants infected with root knot nematodes formed root knots on both tap roots and fibrous roots, which could lead to root necrosis in severe cases”
Claim · model-written summary
Mean tap-root knot weight was 33.71% of total root weight per plant.
- Taxon
- Knoxia roxburghiiKnoxia roxburghiit0
- Interactor
- root knote0pathogen
- Outcome
- mean weight of root knot on the tap rootse0
- Value
- 33.71 %e0
Verbatim
t0“Knoxia roxburghii”
e0“the mean weight of root knot on the tap roots accounted for 33.71 % of the total root weight per plant (n=20)”
Claim · model-written summary
Soil contained 24.25 ± 10.30 nematode juveniles per 100 g.
- Taxon
- Knoxia roxburghiiKnoxia roxburghiit0
- Outcome
- Nematode J2s density within soil samplese0
- Value
- 24.25 ± 10.30 /100 g soile0
Verbatim
t0“Knoxia roxburghii”
e0“Nematode J2s density within soil samples was 24.25 ± 10.30 /100 g soil (n=3)”
Claim · model-written summary
Morphology was consistent with Meloidogyne hapla.
- Taxon
- Meloidogyne hapla
Meloidogyne haplae0 - Outcome
- characteristics consistent with Meloidogyne haplae0
Organisms pictured · Representative pictures of the matched species, not figures from the paper.
Verbatim
t0“Knoxia roxburghii”
e0“Morphological analysis showed characteristics consistent with Meloidogyne hapla”
Claim · model-written summary
D2/D3 and ITS sequences showed 99.78 - 100 % similarity to M. hapla sequences.
- Taxon
- M. haplaMeloidogyne haplae0
- Outcome
- similarity to M. hapla sequencese0
- Value
- 99.78 - 100 %e0
Organisms pictured · Representative pictures of the matched species, not figures from the paper.
Verbatim
t0“Knoxia roxburghii”
e0“D2/D3 and ITS sequencing (GenBank accessions PV747744 and PV746187) revealed 99.78 - 100 % similarity to M. hapla sequences”
Claim · model-written summary
Phylogenetic trees clustered the nematode with M. hapla.
- Taxon
- M. haplaMeloidogyne haplae0
- Outcome
- clustered the nemaode with M. haplae0
Organisms pictured · Representative pictures of the matched species, not figures from the paper.
Verbatim
t0“Knoxia roxburghii”
e0“Phylogenetic trees (MEGA11, neighbor-joining method) clustered the nemaode with M. hapla”
Claim · model-written summary
Nematode inoculation produced galls after 90 days, while controls lacked symptoms.
- Taxon
- Knoxia roxburghiiKnoxia roxburghiit0
- Treatment
- Approximately 1000 J2s per plante1
- Outcome
- typical gall symptomse0
- Comparator
- control groupe0
Not reportedDirection
Verbatim
t0“Knoxia roxburghii”
e0“After 90 days, typical gall symptoms were observed on inoculated plants, whereas no symptoms were detected in the control group”
e1“Approximately 1000 J2s per plant were inoculated onto 30 healthy potted K. roxburghii plants, while 30 potted control plants without nematodes”
Claim · model-written summary
Molecular reconfirmation identified M. hapla after inoculation.
- Taxon
- M. haplaMeloidogyne haplae0
- Outcome
- Molecular reconfirmation confirmed M. haplae0
Organisms pictured · Representative pictures of the matched species, not figures from the paper.
Verbatim
t0“Knoxia roxburghii”
e0“Molecular reconfirmation confirmed M. hapla”
Claim · model-written summary
Inoculated plants had a mean gall index of 1.84 ± 0.94.
- Taxon
- Knoxia roxburghiiKnoxia roxburghiit0
- Interactor
- Meloidogyne haplaMeloidogyne haplat1pathogen
- Outcome
- GIe0
- Value
- 1.84 ± 0.94e0
Organisms pictured · Representative pictures of the matched species, not figures from the paper.
Verbatim
t0“Knoxia roxburghii”
e0“The inoculated K. roxburghii plants had an average of GI 1.84 ± 0.94”
t1“Meloidogyne hapla”
Claim · model-written summary
Inoculated plants had 39.13 ± 17.27 eggs per gram of root.
- Taxon
- Knoxia roxburghiiKnoxia roxburghiit0
- Interactor
- Meloidogyne haplaMeloidogyne haplat1pathogen
- Outcome
- eggs/g roote0
- Value
- 39.13 ± 17.27e0
Organisms pictured · Representative pictures of the matched species, not figures from the paper.
Verbatim
t0“Knoxia roxburghii”
e0“eggs/g root 39.13 ± 17.27”
t1“Meloidogyne hapla”
Claim · model-written summary
Inoculated plants had 14.00 ± 5.62 egg masses per root.
- Taxon
- Knoxia roxburghiiKnoxia roxburghiit0
- Interactor
- Meloidogyne haplaMeloidogyne haplat1pathogen
- Outcome
- egg masses/roote0
- Value
- 14.00 ± 5.62e0
Organisms pictured · Representative pictures of the matched species, not figures from the paper.
Verbatim
t0“Knoxia roxburghii”
e0“egg masses/root 14.00 ± 5.62”
t1“Meloidogyne hapla”
Claim · model-written summary
The reproduction factor was 4.07 ± 1.64.
- Taxon
- Meloidogyne haplaMeloidogyne haplat1
- Outcome
- reproduction factor (RF)e0
- Value
- 4.07 ± 1.64e0
Organisms pictured · Representative pictures of the matched species, not figures from the paper.
Verbatim
t0“Knoxia roxburghii”
e0“a reproduction factor (RF) 4.07 ± 1.64”
t1“Meloidogyne hapla”
Claim · model-written summary
The authors report the first M. hapla infection of K. roxburghii in Yunnan, China.
- Taxon
- Knoxia roxburghiiKnoxia roxburghiit0
- Interactor
- M. haplaMeloidogyne haplae0pathogen
- Outcome
- first report of M. hapla infecting K. roxburghiie0
- Setting
- Yunnan, Chinae0
Organisms pictured · Representative pictures of the matched species, not figures from the paper.
Verbatim
t0“Knoxia roxburghii”
e0“this is the first report of M. hapla infecting K. roxburghii in Yunnan, China”